Correction to ‘RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis’
Year: 2021
Type: erratum
Abstract: The authors wish to introduce the following corrections to their article (1). 1) The DNA sequence for the OLLAS::RPA-1 is incorrect. The correct sequence is: TTCCCCAATTTTTATGTATCTGTTTCAGATAGTGAAAGATGTCCGGATTCGCCAACGAGCTCGGACCACGTCTCATGGGAAAGGCGGCAATTCACATCAATCACGATGTCTTCAATAA 2) In some places in the list of Strains rpa-1 was indicated to be placed on chromosome I, when its correct position is on chromosome II. The published article has been updated. These changes do not affect the results, discussion and conclusions presented in the article.
Source: Nucleic Acids Research
DOI: 10.1093/nar/gkab631
Institution: University of Iowa
Language: English
Topic: DNA Repair Mechanisms
Subfield: Molecular Biology
Domain: Life Sciences
Open Access status: gold
Estimated APC paid: $3,800
OpenAlex ID: W3190255164