Expression of Human ACE2 in Lactobacillus and Beneficial Effects in Diabetic Retinopathy in Mice
Year: 2020
Type: article
Abstract: (Molecular Therapy: Methods & Clinical Development 14, 161–170; September 13, 2019) Following publication, the authors realized that the design of CTB fusion constructs used in the study had not been sufficiently explained in the Materials and Methods. This information is now provided below and has been incorporated into the original online file. The concept of using CTB fusion for systemic protein delivery by the oral route was originally reported by Limaye et al.89Limaye A. Koya V. Samsam M. Daniell H. Receptor-mediated oral delivery of a bioencapsulated green fluorescent protein expressed in transgenic chloroplasts into the mouse circulatory system.FASEB J. 2006; 20: 959-961Crossref PubMed Scopus (80) Google Scholar and has been used for oral delivery of a number of therapeutic proteins, including ACE2 and Ang-(1-7).35,90Shenoy V. Kwon K.C. Rathinasabapathy A. Lin S. Jin G. Song C. Shil P. Nair A. Qi Y. Li Q. et al.Oral delivery of Angiotensin-converting enzyme 2 and Angiotensin-(1-7) bioencapsulated in plant cells attenuates pulmonary hypertension.Hypertension. 2014; 64: 1248-1259Crossref PubMed Scopus (98) Google Scholar A mutant form of CTB, which retains the binding to GM1-ganglioside for cellular uptake but lacks immunomodulatory and toxic activity,91Rodighiero C. Fujinaga Y. Hirst T.R. Lencer W.I. A cholera toxin B-subunit variant that binds ganglioside G(M1) but fails to induce toxicity.J. Biol. Chem. 2001; 276: 36939-36945Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar,92Aman A.T. Fraser S. Merritt E.A. Rodigherio C. Kenny M. Ahn M. Hol W.G. Williams N.A. Lencer W.I. Hirst T.R. A mutant cholera toxin B subunit that binds GM1- ganglioside but lacks immunomodulatory or toxic activity.Proc. Natl. Acad. Sci. USA. 2001; 98: 8536-8541Crossref PubMed Scopus (84) Google Scholar was used in this study. The codons of the CTB sequence were also extensively changed for optimal expression in Lactobacillus. The FC site was based on our previously published sequence,36 which is an artificial FC site designed after careful comparison of available natural protein substrates of furin protease, with enhanced affinity for FC. The codons were also optimized for expression in Lactobacillus species. The DNA sequence for codon-optimized CTB for expression in Lactobacillus species is as follows: 5′-ATGATTAAGTTAAAGTTTGGTGTTTTTTTTACTGTTTTATTATCATCAGCTTACGCTCACGGTACTCCACAAAACATTACTGATTTATGTGCTGAATACCACAACACTCAAATTCACACTTTAAACGATAAGATTTTTTCATACACTGAATCATTAGCTGGTAAGCGTGAAATGGCTATTATTACTTTTAAGAACGGTGCTACTTTTCAAGTTGAAGTTCCAGGTTCACAAGCTATTGATTCACAAAAGAAGGCTATTGAACGTATGAAGGATACTTTACGTATTGCTTACTTAACTGAAGCTAAGGTTGAAAAGTTATGTGTTTGGAACAACAAGACTCCACACGCTATTGCTGCTATTTCAATGGCTAAC-3′. Expression of Human ACE2 in Lactobacillus and Beneficial Effects in Diabetic Retinopathy in MiceVerma et al.Molecular Therapy - Methods & Clinical DevelopmentJuly 10, 2019In BriefThe angiotensin converting enzyme 2 (ACE2) catalyzes the degradation of Angiotensin II (Ang II) to generate Angiotensin-(1-7), which reduces inflammation and oxidative stress stimulated by Ang II. ACE2 has been shown to be protective in cardiovascular and metabolic diseases including diabetes and its complications. However, the challenge for its clinical application is large-scale production of high-quality ACE2 with sufficient target tissue bioavailability. We developed an expression and delivery system based on the use of probiotic species Lactobacillus paracasei (LP) to serve as a live vector for oral delivery of human ACE2. Full-Text PDF Open Access
Authors: Amrisha Verma, Kang Xu, Tao Du, Ping Zhu, Zhibing Liang, Shengquan Liao, Juantao Zhang, Mohan K. Raizada, Maria B. Grant, Qiuhong Li
Language: English
Subfield: Pharmaceutical Science
Domain: Life Sciences
Open Access status: gold
Estimated APC paid: $3,500
OpenAlex ID: W4246581823