Work

Author Correction: Combinatorial selective ER-phagy remodels the ER during neurogenesis

Year: 2025

Type: erratum

Abstract: In the version of the article initially published, in the “Gene editing” section of the Methods, the FAM134A sgRNA target sequence was listed as “TAATACGACTCACTATAG” but should have been “TGCATCACAAACACGACAAGAGG” and the FAM134C sgRNA target sequence was listed as “AACTTGAGCTGTCAGACCAACA” but should have been “CTCTCATTGTCTAATGCGTC”. These errors have now been corrected in the HTML and PDF versions of the article.

Source: Nature Cell Biology

DOI: 10.1038/s41556-025-01670-5

Authors: Melissa J. Hoyer, Cristina Capitanio, Ian R. Smith, Julia C. Paoli, Anna Bieber, Yizhi Jiang, Joao A. Paulo, Miguel A. Gonzalez-Lozano, Wolfgang Baumeister, Florian Wilfling, Brenda A. Schulman, J. Wade Harper

Institutions: Harvard University, Aligning Science Across Parkinson's, Max Planck Institute of Biochemistry, Max Planck Institute of Biophysics

Language: English

Topic: Autophagy in Disease and Therapy

Subfield: Epidemiology

Field: Medicine

Domain: Health Sciences

Open Access status: hybrid

Estimated APC paid: $12,690

OpenAlex ID: W4409448159

Cites:

Cited by:

Related to: 10