Correction to “A Barcoding‐Based Scat‐Analysis Assessment of Eurasian Otter Lutra lutra Diet on Kinmen Island”
Year: 2026
Type: erratum
Abstract: Jang-Liaw, N.-H. A Barcoding-Based Scat-Analysis Assessment of Eurasian Otter Lutra lutra Diet on Kinmen Island. Ecology and Evolution, 2021; 11: 8795–8813. https://doi.org/10.1002/ece3.7712 In Table 2 of the originally published article, the naming of the COI primer sequences FishR1 and FishF2 was incorrectly swapped for Set V and Set VI. The sequence TCGACTAATCATAAAGATATCGGCAC, listed as FishR1 in Set V, is in fact the forward primer FishF2. Conversely, the sequence TAGACTTCTGGGTGGCCAAAGAATCA, listed as FishF2 in Set VI, is the reverse primer FishR1. The correct primer sequences are provided in the updated Table 2 above. This correction pertains solely to the labeling of primer names in Table 2. The primer sequences themselves, laboratory procedures, and all analyses and conclusions presented in the article remain unchanged and are not affected by this error. I apologize for this error.
Source: Ecology and Evolution
DOI: 10.1002/ece3.73144
Language: English
Subfield: Ecology
Field: Environmental Science
Domain: Physical Sciences
SDG: Life below water
Open Access status: gold
Estimated APC paid: $2,570
OpenAlex ID: W7130657965
Cites:
Cited by:
Related to: