Aphanogmus kintrishi Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus kintrishi Salden, Mikó & Peters sp. nov. Figs 15, 16; Suppl. material 12 Material examined. Holotype: Georgia • ♂; Adjara, Kintrishi; 41.7372°N, 41.9792°E; ca. 400 m a. s. l.; 27 Jul. – 10 Aug. 2018; L. Mumladze leg.; Malaise trap; ZFMK; ZFMK -HYM-00042502. Paratypes: Georgia • 1 ♀; same data as for holotype; ECAUG; ZFMK -HYM-00042503 • 1 ♂; same data as for holotype; 13–27 Jul. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042505 • 1 ♂; same data as for holotype; 10–24 Aug. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042504 • 1 ♀, 1 ♂; same data as for holotype; 24 Aug. – 7 Sep. 2018; L. Mumladze leg.; Malaise trap; ZFMK; ZFMK -HYM-00042506, ZFMK -HYM-00042509 • 1 ♂; same data as for holotype; 7–21 Sep. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042510 (without DNA barcode) • 1 ♀; same data as for holotype; 5–19 Oct. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042508. Diagnostic description. Male. Body length: 0.85 mm. Colour (Fig. 15 A): Body brown except scape and legs yellowish. Antenna, head (Fig. 15 A): F 1 with sensillae arranged in at least four whorled rows, F 1 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea present. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 15 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus present. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent, with small setal patch at posterior margin of the mesometapleuron next to base of metacoxa. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Two basal longitudinal carinae on syntergum. Male genitalia (Fig. 15 B – D): Gvc length one third of mesonotum length. Gvc width 0.67 × gvc length; harpe / gvc index 0.45. Harpe finger-shaped, oriented distoventrally, and gradually narrowing towards apex; lateral margin of harpe convex in basal third, straight in apical two-thirds, and oriented distomedially; median margin of harpe concave in basal half, straight in apical half, and oriented distally. Harpe with basomedian spine; tip of basomedian spine distinctly more proximal than tip of gonossiculus and oriented distally; harpe with distinct triangular median lamella-like extension at mid-length; tip of triangular median lamella-like extension rounded and oriented medially. Proximodorsal notch of harpe U-shaped and 0.30 × as long as harpe length. Harpe width (above basomedian spine) 0.22 × gvc width, and 0.29 × harpe length. Harpe with four median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least five apical setae oriented distally, including one distinctly broadened seta with blunt end (visible only in CLSM image Suppl. material 12); harpe with one ventral seta, oriented distolaterally. Gonossiculus length 0.40 × harpe length; gonossiculus J-shaped with three digital teeth, tips oriented dorsolaterally. Aedeagus straight. Female. Body length: 1.00 mm. Colour (Fig. 16): Body brown except scape and legs yellowish. F 6 – F 8 darker than scape, pedicel, and F 1 – F 5. Antenna, head (Fig. 16): F 8 length longer than half of scape length. Preoccipital lunula present. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea present. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 16): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent, with small setal patch at posterior margin of the mesometapleuron next to base of metacoxa. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Five basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 0.0 % (n = 7). Minimum interspecific barcode distance: 16.8 % (A. latiharpus). Consensus sequence: 5 ’ - AGCCAGTTTAAGAATCCTAGTTCGACTTGAGCTAAGAAGACCCCCCAATAATATAATCAATAATGATCTAATTTACAATTCAATTATCACAGCCCATGCCTTTGTAATAATTTTTTTTTTAGTCATACCCATCATACTGGGAGGATTTGGAAACTGGCTCCTGCCCCTAATAATTGGATCCCCGGATCTAGCCTTTCCCCGAATAAATAACATAAGATTTTGACTCCTCCCTCCCTCCCTTACCCTACTAATCAATAGGATAATTATAAACTCAGGGACTGGCGCTGGATGAACTCTTTACCCCCCCCTCACCTCCAATCTTCATCATTCCGGCATAGCAATAGATCTAACCATTTTCTCCCTACACGTAGCAGGAATTAGATCCATCATAGGCTCCATCAACTTCTTAGTTACCCTATATAAAATAAAACCCCCCGCCTTCACCCCGGAAATCATGCCCCTTTTCTGTTGATCAGTAGTAATCACCACCCTTCTACTTATCCTATCTCTCCCGGTCTTAGCTGGAGCTATTACCATAATCTTAACAGATCGCAACTTAAACACTTCCTTTTTTGACCCTAGTGGAGGTGGAGACCCCATTCTTTACCAGCATCTTTTT - 3 ’ Variation. Unknown. Biology. Unknown. Distribution. Palaearctic: Georgia. Etymology. The species is named after the Kintrishi river and the Kintrishi National Park, where the type series were collected. The species epithet is treated as a noun in apposition. Remarks. Aphanogmus kintrishi can be distinguished from all other species of the A. fumipennis species group by a striking and unique character, i. e, the presence of a small setal patch at the posterior margin of the mesometapleuron next to the base of the metacoxa, which is present in both males and females (Figs 15 A, 16). The male genitalia of A. kintrishi may be confused with those of the Afrotropical species A. pilosicoxa Salden & Peters, 2023, as both species exhibit a similar overall morphology, including comparable setal arrangements on the harpes, similar gonossiculi, and a median extension on the harpe (Fig. 15 D). However, closer examination reveals several diagnostic differences (Fig. 15 D): A basomedian spine of the harpe is present in A. kintrishi but absent in A. pilosicoxa, the harpe width to length ratio is higher in A. kintrishi (0.29) than in A. pilosicoxa (0.20), in A. kintrishi the harpes have a distinct triangular median lamella-like extension at mid-length, in A. pilosicoxa the harpes have a median extension at the base and a slim convex median lamella-like extension in the apical two-thirds. In the molecular analyses, one female specimen from Norway (NOCER-435) is also included in this species, but only when using mPTP. It is delimited by the other two methods ASAP and objective clustering, its distance to the type series is 6.5 %. Morphological examination of this singleton female does not allow reliable assessment. Integrating all data, this specimen is not considered as part of the species A. kintrishi. For further morphological comparisons, see remarks under A. karlazani.
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Language: English
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140196284