Aphanogmus ventricoharpus Salden, Staverlokk, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus ventricoharpus Salden, Staverløkk, Mikó & Peters sp. nov. Figs 25, 26; Suppl. materials 16, 17 Material examined. Holotype: Norway • ♂; Telemark, Drangedal: Sannes gård; 59.0296°N, 9.2955°E; ca. 80 m a. s. l.; 4 Aug. – 22 Sep. 2021; A. Staverløkk leg.; Malaise trap; NINA; NOCER-291. Paratypes: Norway • 5 ♀♀; same data as for holotype; NINA; NOCER-333, NOCER-330, NOCER-331, NOCER-329, NOCER-328 • 1 ♀; same data as for holotype; 23 Jun. – 19 Jul. 2021; A. Staverløkk leg.; Malaise trap; NINA; NOCER-392 • 1 ♂; same collection data as for preceding; NINA; NOCER-373 (without DNA barcode). Georgia • 1 ♀; Kakheti, Vashlovani; 41.1847°N, 46.5628°E; ca. 340 m a. s. l.; 20–28 Jun. 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042461 • 1 ♀; Racha-Lechkhumi & Kvemo Svaneti, Doghurashi; 42.6698°N, 42.7854°E; ca. 1000 m a. s. l.; 18–24 Aug. 2020; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042463. Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 16–30 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_000905 • 1 ♀; same collection data as for preceding; 4–18 Jun. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001240 • 1 ♂; Bavaria, Kronach, Küps; 50.21°N, 11.27°E; ca. 340 m a. s. l.; 04–10 Jul. 2022; NaPa Insektenmonitoring leg.; vane trap; ZFMK; ZFMK -HYM-00042670 (without DNA barcode) • 3 ♂♂; Saxony-Anhalt, Börde, Oschersleben; 52.00°N, 11.41°E; ca. 90 m a. s. l.; 18–24 Jul. 2022; NaPa Insektenmonitoring leg.; vane trap; ZFMK; ZFMK -HYM-00042671, ZFMK -HYM-00042672, ZFMK -HYM-00042674 (without DNA barcodes). Other material examined. Germany • 1 ♂; Hesse, Hersfeld-Rotenburg, Rockensüß, doline; 51.0489°N, 9.8372°E; ca. 310 m a. s. l.; 16 Sep. – 14 Nov. 2012; H. - J. Flügel leg.; Malaise trap; UNHC; PSUC_FEM 10022777 (without DNA barcode) • 1 ♂; Baden-Württemberg, Tübingen, Franz. Viertel, Aue Blaulach; 48.5089°N, 9.0786°E; ca. 340 m a. s. l.; 14 Jun. 2012; UNHC; PSUC_FEM 10022748. Hungary • 1 ♂; Bács-Kiskun, Miklapuszta; 1 Jul. 1997; É. Kovács leg.; yellow pan trap; UNHC; PSUC_FEM 10022764 (without DNA barcode) • 2 ♂♂; Bács-Kiskun, Gara; 46.035°N, 19.020°E; ca. 90 m a. s. l.; 26–30 Jun. 2009; I. Mikó leg.; yellow pan trap; UNHC; UNHC_1000079, UNHC_1000080 (without DNA barcodes). Diagnostic description. Male. Body length: 0.70 mm. Colour (Fig. 25 A): Body brown. Legs with lighter joints and tarsi. Antenna, head (Fig. 25 A): F 1 with sensillae arranged in four whorled rows, F 1 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly before POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 25 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus slightly indicated. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex very short. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Two basal longitudinal carinae on syntergum. Male genitalia (Fig. 25 B – D): Gvc length slightly less than half of mesonotum length. Gvc width 0.95 × gvc length; harpe / gvc index 0.49. Harpe bulbous, slightly distoventrally oriented, and gradually narrowing towards apex; lateral margin of harpe slightly convex in basal half, slightly concave in distal half, and oriented distally; median margin of harpe concave in basal third, strongly convex in apical two-thirds, and diverging distolaterally. Harpe with basomedian spine; tip of basomedian spine more proximal than tip of gonossiculus and oriented distally; harpe with distinctly convex and broad median lamella-like extension at mid-length. Proximodorsal notch of harpe U-shaped and 0.14 × as long as harpe length. Harpe width (above basomedian spine) 0.29 × gvc width, and 0.53 × harpe length. Harpe with at least eight median setae oriented distomedially, extending to apical third; harpe with at least four apical setae oriented distomedially; harpe with one lateral seta, oriented distolaterally. Gonossiculus length 0.53 × harpe length; gonossiculus J-shaped with at least one digital tooth, tip oriented dorsolaterally. Aedeagus indistinct. Female. Size: 0.65 mm. Colour (Fig. 26): Body brown except metasoma lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 26): F 8 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends at anterior ocellus. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 26): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus slightly visible. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Four basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 2.2 % (n = 11). Minimum interspecific barcode distance: 11.8 % (putative species consisting of SMNS _Hym_Cer_001242, SMNS _Hym_Cer_001698, and SMNS _Hym_Cer_001722). Consensus sequence: 5 ’ - AGCAGGATTAAGATTTATCATCCGTCTTGAATTAAGATCTCCCCCCAACAACATAATAAATAATGACCTAATTTATAATTCTGTTATCACCAATCATGCCTTCCTGATAATTTTTTTTTTAGTTATACCTATTATACTTGGAGGATTTGGAAACTGACTTATCCCCCTTATAATTGGCTCCCCAGATTTAGCCTTCCCTCGAATAAATAACATAAGACTTTGACTCCTACCCCCCTCTTTAACCCTTCTCCTTATTAGAATAATAACCAATACAGGTGTGGGGGCAGGATGAACCCTTTATCCTCCCCTTACTTTAGTCCCCTTTCATGATGGGATGTCAATAGATTTAACAATCTACTCTCTTCACATCGCAGGAATCAGTTCAATCATAGGTTCAATCAATTTTATAGTAACTACATACAAAATGAAACCCCCCCTTCAAAATATAATATCCCTCCCCCTTTTCTGTTGATCAATTATAATTACCTCCCTACTCCTTCTACTTTCTCTTCCTGTTTTAGCTGGGGCTGTAACAATAATCCTAACAGACCGAAACTTAAATACTTCTTTTTTTGATCCAGAAGGGGGGGGAGACCCTCTCCTCTATCAACATTTATTC - 3 ’ Variation. Unknown. Biology. Unknown. Distribution. Palaearctic: Georgia, Germany, Hungary, and Norway. Etymology. The species name is a composition of the Latin word ‘ ventricosus ’, which means ‘ bulging’ and the anatomical term ‘ harpe’, with reference to the convex median margin of the harpe. Remarks. Aphanogmus ventricoharpus can be distinguished from all other species of the A. fumipennis species group by the conspicuous male genitalia, specifically by the distinctly convex and broad median lamella-like extension of the harpes, which are gradually narrowing towards the apex, giving the harpe a bulbous outline (Fig. 25 D).
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Language: English
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140214385