Aphanogmus trigoharpus Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus trigoharpus Salden, Mikó & Peters sp. nov. Figs 21, 22; Suppl. material 14 Material examined. Holotype: Georgia • ♂; Adjara, Kintrishi; 41.7294°N, 42.0775°E; ca. 1020 m a. s. l.; 1–15 Jun. 2018; L. Mumladze leg.; Malaise trap; ZFMK; ZFMK -HYM-00042511. Paratypes: Georgia • 1 ♀; Adjara, Kintrishi; 41.7372°N, 41.9792°E; ca. 400 m a. s. l.; 13–27 Jul. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042514 • 1 ♀; same collection data as for preceding; 27 Jul. – 10 Aug. 2018; L. Mumladze leg.; Malaise trap; ZFMK; ZFMK -HYM-00042516 • 1 ♀; same collection data as for preceding; 10–24 Aug. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042513 • 1 ♀; same collection data as for preceding; 7–21 Sep. 2018; L. Mumladze leg.; Malaise trap; ZFMK; ZFMK -HYM-00042517 • 1 ♀; same collection data as for preceding; 21 Sep. – 5 Oct. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042518. Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 16–30 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_000918. Diagnostic description. Male. Body length: 0.85 mm. Colour (Fig. 21 A): Body light brown except metasoma, antenna, and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 21 A): F 1 with sensillae arranged in three whorled rows, F 1 length shorter than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 21 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Median mesoscutal sulcus indicated. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Four basal longitudinal carinae on syntergum. Male genitalia (Fig. 21 B – D): Gvc length one third of mesonotum length. Gvc width 0.63 × gvc length; harpe / gvc index 0.52. Harpe triangular in apical two-thirds, distoventrally oriented, and gradually narrowing towards apex; lateral margin of harpe straight and oriented distomedially; median margin of harpe concave in basal third and straight in apical two-thirds, oriented distolaterally. Harpe without spines along median margin; harpe with distinct triangular median extension at mid-length; tip of distinct triangular median extension rounded and oriented medially. Proximodorsal notch of harpe absent. Harpe width (below distinct triangular median extension) 0.24 × gvc width, and 0.33 × harpe length. Harpe with four median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least six apical setae oriented distally, including one broadened seta (broadening visible only in CLSM image Suppl. material 14); harpe with one ventral seta, oriented distolaterally. Gonossiculus length 0.66 × harpe length; gonossiculus with at least two digital teeth, tips oriented distodorsally. Aedeagus straight. Female. Body length: 0.90 mm. Colour (Fig. 22): Body brown except metasoma, scape, and legs yellowish. Antenna, head (Fig. 22): F 8 length half of scape length. Preoccipital lunula present. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 22): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus present. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Five basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 0.7 % (n = 7). Minimum interspecific barcode distance: 8.1 % (putative species consisting of ZFMK -HYM-00042521, ZFMK -HYM-00042522, ZFMK -HYM-00042519, ZFMK -HYM-00042520, NOCER-374, and NOCER-388). Consensus sequence: 5 ’ - TGCAAGTTTAAGCCTATTAATTCGCCTAGAATTAAGTAGCCCCCCTAATAACCTAATTAACAATGATTTAATTTATAACTCTATTATTACCGCCCATGCCTTTGTAATAATTTTCTTCCTTGTCATACCTATTATATTAGGAGGATTTGGCAACTGACTACTCCCCCTAATAATTGGCTCCCCAGACTTAGCCTTCCCCCGAATAAATAATATAAGATTCTGATTACTCCCCCCCGCATTAATCCTTTTGATAAACAGAATGATAATAAACTCTGGCACTGGAGCAGGATGAACCCTCTATCCCCCCCTTACATCTAATCTCCATCACTCCGGCATCGCAATAGACTTAACTATCTTTTCCCTTCATGTAGCAGGAATTAGCTCAATCATAGGGTCAATTAATTTCCTAGTCACCCTTTATAAAATAAAACCCTTAAACTTCCAACAAGAAATAATACCTCTATTTTGTTGATCCGTAGTAATCACAACAATCTTACTCATTCTCTCCCTCCCAGTTCTAGCAGGAGCTATCACTATGATTTTAACAGACCGAAATCTTAATACCTCCTTCTTCGACCCCAGAGGTGGAGGAGACCCTGTTTTATACCAACACTTATTT - 3 ’ Variation. Unknown. Biology. Unknown. Distribution. Palaearctic: Georgia, Germany, and Norway. Etymology. The species name is a composition of the Greek word ‘ τρίγωνος’ (trígōnos), which means ‘ triangular’, and the anatomical term ‘ harpe’, with reference to the triangular harpe. Remarks. Aphanogmus trigoharpus is clearly differentiated from the other species of the A. fumipennis species group by a triangular harpe in the apical two-thirds, combined with the absence of spines and of a proximodorsal notch of the harpe (Fig. 21 D). In the molecular analyses, one female specimen from Georgia (ZFMK -HYM-00042523) is also included in this species, but only when using ASAP. It is delimited by the other two methods mPTP and objective clustering, its minimum distance to the type series is 5.3 %. Morphological examination of this singleton female does not allow reliable assessment. Integrating all data, this specimen is not considered as part of the species A. trigoharpus.
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Language: English
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140206524