Aphanogmus hamatogonus Salden, Staverlokk, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus hamatogonus Salden, Staverløkk, Mikó & Peters sp. nov. Figs 11, 12; Suppl. material 9 Material examined. Holotype: Norway • ♂; Trøndelag, Soknedal; 62.9786°N, 10.2206°E; ca. 210 m a. s. l.; 8 Jul. – 11 Aug. 2020; A. Staverløkk leg.; Malaise trap; NINA; NOCER-09. Paratypes: Norway • 1 ♀; same data as for holotype; NINA; NOCER-550 • 1 ♀; Aurskog-Høland, Mikkelsrud; 59.9754°N, 11.6683°E; ca. 300 m a. s. l.; 9 May – 13 Jun. 2022; A. Staverløkk leg.; Malaise trap; NINA; NOCER-852. Other material examined. Germany • 1 ♂; North Rhine-Westphalia, Eifel National Park, Döppeskaul; 21 Sep. – 5 Oct. 2009; J. Esser leg.; Malaise trap; UNHC; PSUC_FEM 10022941 (without DNA barcode) • 1 ♂; Saxony, Bautzen, Driewitz; 51.3456°N, 14.4348°E; ca. 150 m a. s. l.; 30 Jul. 2013; L. Krogmann, T. Kothe leg.; sweep net; UNHC; PSUC_FEM 10022914 (without DNA barcode) • 1 ♂; Baden-Würrtemberg, Lörrach, nature reserve Buchswald Grenzach; 47.5575°N, 7.6972°E; ca. 370 m a. s. l.; 6 Aug. 2013; T. Kothe, P. Bergmann leg.; sweep net; UNHC; PSUC_FEM 10022812 (without DNA barcode). Diagnostic description. Male. Body length: 0.90 mm. Colour (Fig. 11 A): Body brown except legs and antenna lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 11 A): F 1 with sensillae arranged in at least four whorled rows, F 1 longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 11 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus slightly visible. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. No basal longitudinal carinae on syntergum. Male genitalia (Fig. 11 B – D): Gvc length slightly less than half of mesonotum length. Gvc width 0.63 × gvc length; harpe / gvc index 0.36. Harpe finger-shaped, distoventrally oriented; lateral margin of harpe slightly concave at mid-length and slightly oriented distomedially; median margin of harpe with small extension in basal quarter, straight in apical three-quarters, and slightly converging distomedially. Harpe with basomedian spine and small spine-like structure lateral to basomedian spine; tip of basomedian spine about as distal as tip of gonossiculus and oriented distally; tip of small spine-like structure more proximal than tip of gonossiculus, gradually narrowing towards apex, and oriented distally. Proximodorsal notch of harpe lateral to small spine-like structure, V-shaped, and 0.16 × as long as harpe length. Width of harpe (above small median extension in basal quarter of harpe) 0.12 × gvc width, and 0.17 × harpe length. Harpe with three median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least four apical setae oriented distally; harpe with one lateral seta close to apex, oriented distolaterally. Gonossiculus length 0.52 × harpe length; gonossiculus C-shaped with at least one digital hook-shaped tooth, tip oriented dorsally. Aedeagus straight. Female. Body length: 0.90 mm. Colour (Fig. 12): Body brown except metasoma, antenna and legs lighter. Legs with lighter joints and tarsi. Antenna with slightly darker F 6 – F 8. Antenna, head (Fig. 12): F 8 length half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 12): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Two basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 2.5 % (n = 3). Minimum interspecific barcode distance: 15.1 % (A digitangulus). Consensus sequence: 5 ’ - GGCAGGCCTTAGCCTCATTATTCGTCTTGAATTAAGRTCCCCCCCCAATAACATAATAAATAACGATTTAATCTATAACTCTGTAATTACCAATCATGCCTTTTTAATAATTTTTTTTCTGGTCATACCTATTATATTGGGGGGCTTTGGAAATTGACTAATCCCCATTATAATTGGGGCTCCGGATCTAGCCTTCCCTCGAATAAATAATATGAGACTGTGATTACTCCCCCCCTCTTTAACCCTCCTTCTAATAAGTATAATAACTAATACGGGTGTAGGAGCAGGTTGGACCCTTTACCCCCCTTTAACTTTAATACCCTTCCATGATGGAATATCAATAGACTTAACAGTTTATTCCCTCCATATTGCAGGAATTAGCTCAATTATAGGCTCAATCAATTTCATAGTTACCACTTATAAAATAAAACCCTCCCCCCAAATTTTAACATCCCTCCCTCTATTCTGTTGATCAATTATAATTACTTCCCTTCTCCTCATCCTCTCCCTACCCGTCTTAGCCGGAGCTGTAACAATAATTCTCACCGATCGCAACTTAAATACTTCATTTTTTGATCCAGAAGGGGGGGGTGACCCCCTACTCTATCAACATTTATTC - 3 ’ Variation. Unknown. Biology. Unknown. Distribution. Palaearctic: Germany and Norway. Etymology. The species name is a composition of the Latin word ‘ hamatus ’, meaning ‘ hooked’, and a short form of the anatomical term gonossiculus, with reference to the hook-shaped tooth of the gonossiculus of the male genitalia. Remarks. Aphanogmus hamatogonus can be distinguished from all other species of the A. fumipennis species group by its small spine-like structure lateral to the basomedian spine of the harpe, in combination with a small median extension in the basal quarter of the harpe, and a hook-shaped tooth of the gonossiculus (Fig. 11 D). For further comparisons, see remarks under A. fumipennis.
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Language: English
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140194894