Aphanogmus hafti Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus hafti Salden, Mikó & Peters sp. nov. Figs 9, 10; Suppl. materials 7, 8 Material examined. Holotype: Germany • ♂; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 2–16 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_T 00805 (= SMNS_Hym_Cer_001108). Paratypes: Georgia • 1 ♀; Racha-Lechkhumi & Kvemo Svaneti, Doghurashi; 42.6782°N, 42.8101°E; ca. 1470 m a. s. l.; 17–24 May 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042444 • 1 ♀; same collection data as for preceding; 18–24 Aug. 2020; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042443 • 1 ♀; Racha-Lechkhumi & Kvemo Svaneti, Doghurashi; 42.6990°N, 42.8267°E; ca. 1800 m a. s. l.; 20–26 Jun. 2020; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042442 • 1 ♂; Adjara, Kintrishi; 41.7554°N, 42.1130°E; ca. 2280 m a. s. l.; 25 Aug. – 8 Sep. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042441 (without DNA barcode). Other material examined. Germany • 1 ♂; Baden-Württemberg, Esslingen, Oberboihingen, meadow orchard; 48.6506°N, 9.3689°E; ca. 310 m a. s. l.; 10–23 Jun. 2012; T. Kothe, G. Schweizer leg.; Malaise trap; UNHC; PSUC_FEM 10022947 (without DNA barcode) • 1 ♂; same collection data as for preceding; 12–26 Aug. 2012; T. Kothe, G. Schweizer leg.; Malaise trap; UNHC; PSUC_FEM 10022845 (without DNA barcode). Diagnostic description. Male. Body length: 0.90 mm. Colour (Fig. 9 A): Body brown except metasoma and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 9 A): F 1 with sensillae arranged in three whorled rows, F 1 length slightly shorter than half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 9 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex short. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Indistinct basal longitudinal carinae on syntergum. Male genitalia (Fig. 9 B – D): Gvc length one third of mesonotum length. Gvc width 0.70 × gvc length; harpe / gvc index 0.48. Harpe finger-shaped, distoventrally oriented; lateral margin of harpe convex in basal half, straight in apical half, and oriented distally; median margin of harpe concave in basal quarter, convex in apical three-quarters, and slightly oriented distolaterally. Harpe with basomedian spine; tip of basomedian spine more distal than tip of gonossiculus and oriented distolaterally; harpe with slim median lamella-like extension along apical half. Proximodorsal notch of harpe U-shaped and 0.37 × as long as harpe length. Harpe width (above basomedian spine) 0.19 × gvc width, and 0.23 × harpe length. Harpe with four median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least four apical setae oriented distally; harpe with one lateral seta close to apex, oriented distolaterally. Gonossiculus length 0.46 × harpe length; gonossiculus C-shaped with at least two digital teeth, tips oriented dorsolaterally. Aedeagus indistinct. Female. Body length: 1.00 mm. Colour (Fig. 10): Body brown except legs lighter. Antenna, head (Fig. 10): F 8 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 10): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex distinct. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Four basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 2.9 % (n = 4). Minimum interspecific barcode distance: 15.1 % (A. digitangulus). Consensus sequence: 5 ’ - AGCTGGACTTAGCCTAATTATTCGCTTAGAATTAAGATCCCCCCCTAATAACATAATAAACAATGACCTRATTTACAACTCTGTAATCACCAATCATGCATTTTTAATAATTTTTTTCCTTGTTATGCCAGTYATACTAGGGGGATTTGGAAACTGACTAATCCCTATTATAATTGGTGCCCCAGATTTAGCTTTCCCTCGAATAAACAATATAAGTCTTTGACTACTCCCYCCCTCTTTAACCCTCCTTCTCACAAGAATAATAACCAATACCGGAGTCGGAGCAGGRTGAACCCTTTACCCCCCCTTAACTCTAACCCCCTTCCATGATGGAATATCAATAGACCTCACAATTTACTCCCTTCATATTGCAGGTCTTAGCTCAATTATAGGATCTATTAATTTCATAGTAACAACCTACAAAATAAAACCTTCCCCTCAATCCATTCTATCCCTCCCCCTATTCTGTTGATCAATTATAATTACCTCCTTACTCCTACTTCTATCCCTCCCCGTCTTAGCTGGAGCCATTACAATAATCCTCACTGACCGAAATTTAAATACTTCATTTTTTGACCCAGAAGGRGGGGGAGACCCCCTTCTTTACCAACATTTATTC - 3 ’ Variation. The colouration of the male specimen ZFMK -HYM-00042441 is dark brown and the specimen is equipped with four basal longitudinal carinae on the syntergum. F 8 is as long as half of the scape length in ZFMK -HYM-00042442 and ZFMK -HYM-00042443. The interaxillar sulcus is present in PSUC_FEM 10022947 and PSUC_FEM 10022845 (visible in µCT image Suppl. material 8). Biology. Unknown. Distribution. Palaearctic: Georgia and Germany. Etymology. The species is named after the nature-enthusiastic documentary filmmaker Jan Haft. With his camera, he opens doors to countless hidden stories of nature. Remarks. Aphanogmus hafti can be distinguished from all other species of the A. fumipennis species group by the distolaterally oriented basomedian spine of the harpe and the slim median lamella-like extension along the apical half of the harpe (Fig. 9 D).
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140182505