Aphanogmus crispy Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus crispy Salden, Mikó & Peters sp. nov. Figs 5, 6; Suppl. materials 3, 4 Material examined. Holotype: Georgia • ♂; Kakheti, Gombori; 41.8594°N, 45.2183°E; ca. 1100 m a. s. l.; 21–28 Jul. 2021; G. Japoshvili leg.; Malaise trap; ECAUG; ZFMK -HYM-00042477. Paratypes: Georgia • 1 ♂; Kakheti, Gombori; 41.8739°N, 45.3553°E; ca. 1060 m a. s. l.; 20–27 Jul. 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042483 • 1 ♂; same collection data as for preceding; ZFMK; ZFMK -HYM-00042490 (without DNA barcode) • 1 ♀; Racha-Lechkhumi & Kvemo Svaneti, Doghurashi; 42.6698°N, 42.7854°E; ca. 1070 m a. s. l.; 17–24 May 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042482 • 4 ♀♀; Racha-Lechkhumi & Kvemo Svaneti, Doghurashi; 42.6782°N, 42.8101°E; ca. 1470 m a. s. l.; 17–24 May 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042478, ZFMK -HYM-00042479, ZFMK -HYM-00042480, ZFMK -HYM-00042495 • 1 ♀; Kakheti, road to Sakisto Lake; 44.2559°N, 45.3356°E; ca. 900 m a. s. l.; 29 May 2022; R. S. Peters leg.; sweep net; ZFMK; ZFMK -HYM-00042489 • 1 ♀; Kakheti, Telavi; 41.9132°N, 45.4556°E; ca. 820 m a. s. l.; 29 May 2022; T. Salden, R. S. Peters leg.; yellow pan trap; ZFMK; ZFMK -HYM-00042488 • 3 ♀♀; same collection data as for preceding; 30 May 2022; T. Salden, R. S. Peters leg.; yellow pan trap; ZFMK; ZFMK -HYM-00042484, ZFMK -HYM-00042486, ZFMK -HYM-00042485. Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 9–23 Apr. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001611 • 1 ♀; same collection data as for preceding; 7–21 May 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001178 • 1 ♀; Baden-Württemberg, Enzkreis, Königsbach-Stein, NSG 2.119 Beim Steiner Mittelberg; 48.9704°N, 8.6590°E; ca. 230 m a. s. l.; 19 Jun. – 3 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001692 • 1 ♂; North Rhine-Westphalia, Haltern-Borkenberge, raised bog; 51.751°N, 7.264°E; ca. 60 m a. s. l.; 19–31 Jul. 2023; K. Hannig leg.; Malaise trap; ZFMK; ZFMK -HYM-00042655 (without DNA barcode) • 1 ♂; North Rhine-Westphalia, ZFMK garden; 50.7216°N, 7.1141°E; ca 60 m a. s. l.; 30 Aug. 2022; T. Salden leg.; sweep net; ZFMK; ZFMK -HYM-00042658 (without DNA barcode) • 2 ♂♂; Hesse, Werra-Meißner-Kreis, Großalmerode, private garden, Siedlerweg, semi-abandoned garden with wet spot, ivy hedge and salix; 51.2591°N, 9.7871°E; ca 380 m a. s. l.; 12–20 Jul. 2022; J. Vogel leg.; Malaise trap; ZFMK; ZFMK -HYM-00042666; ZFMK -HYM-00042669 (without DNA barcodes). Sweden • 3 ♂♂; Gotland, Eksta socken, Stora Karlsö; 57.2841°N, 17.9700°E; ca. 30 m a. s. l.; 15 Aug. – 3 Sep. 2023; Hym inventory 2023 leg.; Malaise trap; NHRS; NHRS -HEVA 000023405, NHRS -HEVA 000023406, NHRS -HEVA 000023407 (without DNA barcodes). Switzerland • 1 ♂; Aargau, Lenzburg; 47.38°N, 8.19°E; ca. 440 m a. s. l.; 24–30 Oct. 2022; NaPa Insektenmonitoring leg.; vane trap; ZFMK; ZFMK -HYM-00042668 (without DNA barcode). Other material examined. Czech Republic • 1 ♂; South Moravia, Lednice, riparian forest; 9 Aug. 1991; L. Masner leg.; sweep net; UNHC; UNHC_1000016 (without DNA barcode). Germany • 2 ♂♂; Saxony, Bautzen, Driewitz; 51.3456°N, 14.4348°E; ca. 150 m a. s. l.; 30 Jul. 2013; L. Krogmann, T. Kothe leg.; sweep net; UNHC; 10022913, 10022906 (without DNA barcodes) • 1 ♂; Saxony, Görlitz, Oppach; 51.0619°N, 14.4922°E; ca. 330 m a. s. l.; 18–24 Aug. 2013; U. Hornig leg.; Malaise trap; UNHC; 10022925 (without DNA barcode). Norway • 1 ♂; Vestfold, Larvik, Bommestad; 59.0814°N, 10.0754°E; ca. 30 m a. s. l.; 3 Oct. 2017; A. Staverløkk leg.; sweep net; NINA; MS- 141 (without DNA barcode). Sweden • 1 ♂; Stenbrohult, Djäknabygds bokbacke, heath with old beeches, Trap ID 24; 1–18 Aug. 2003; UNHC; IM 2144 (without DNA barcode). Diagnostic description. Male. Body length: 0.90 mm. Colour (Fig. 5 A): Body brown except metasoma and legs slightly lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 5 A): F 1 with sensillae arranged in three whorled rows, F 1 length half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 5 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus present. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex very short. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. No basal longitudinal carinae on syntergum. Male genitalia (Fig. 5 B – D): Gvc length one third of mesonotum length. Gvc width 0.74 × gvc length; harpe / gvc index 0.46. Harpe finger-shaped, distoventrally oriented, slightly narrowed along apical two-thirds; lateral margin of harpe slightly convex in basal third, slightly concave in apical two-thirds, and oriented distally; median margin of harpe slightly concave in basal third, straight in apical two-thirds, and oriented distally. Harpe with median spine; tip of median spine about as distal as tip of gonossiculus and oriented distomedially. Proximodorsal notch of harpe absent, mediodorsal notch of harpe V-shaped and 0.19 × as long as harpe length. Harpe width (above median spine) 0.13 × gvc width, and 0.21 × harpe length. Harpe with four median setae oriented proximomedially and distomedially, extending to apical third; harpe with at least four apical setae oriented distally, including one broadened seta (broadening only visible in CLSM image Suppl. material 3); harpe with one lateral seta close to apex, oriented distolaterally. Gonossiculus length 0.46 × harpe length; gonossiculus J-shaped with knob-like apex, at least one digital tooth, tip oriented dorsolaterally. Aedeagus straight. Female. Body length: 0.90 mm. Colour (Fig. 6): Body light brown except metasoma and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 6): F 8 length half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 6): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein distinctly oriented towards anterior wing margin. Two basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 3.3 % (n = 15). Minimum interspecific barcode distance: 10.5 % (putative species consisting of NOCER-771 and NOCER-389). Consensus sequence: 5 ’ - AGCTGGACTTAGCCTGATCATCCGCTTAGAACTAAGGTCTCCCCCCAATAATTTAATAAATAATGACCTAATCTACAATACTGTAATTACTAACCATGCCTTTCTAATAATTTTTTTCCTAGTCATACCTGTTATAATGGGGGGTTTCGGTAATTGACTAACCCCTGTAATAATTGGCGCCCCTGACCTCTCCTTCCCCCGAATAAACAACATGAGATTGTGGTTACTCCCCCCCTCTCTTTCTATACTTTTAATAAGAATAACAACTAACACTGGAGTAGGAGCAGGATGAACCCTTTACCCCCCCTTAACCCTTGCCCCCTTCCATGATGGAATATCAATAGATATAACAATTTTCTCTCTCCATATCGCTGGCATCAGCTCAATTATAGGCTCAATTAATTTTCTAGTAACTATCATAAAAATAAGACCCTCCCCCCAAGCACTAATCACCCTCCCTTTATTTTGCTGATCTATCATAATCACCTCCCTTCTTCTCCTCCTTTCCTTACCTGTCTTAGCAGGAGCTGTAACCATACTTCTGACTGACCGTAACATAAATACCTCTTTTTTCGACCCCGAAGGGGGAGGAGACCCCCTCCTCTACCAACACCTATTT - 3 ’ Variation. The anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex is more distinct in ZFMK -HYM-00042490 than in the holotype (ZFMK -HYM-00042477) and seemingly absent in 10022906, 10022913, and 10022925 (visible in µCT image Suppl. material 4). Biology. Unknown. Distribution. Palaearctic: Czech Republic, Georgia, Germany, Norway, Sweden, and Switzerland. Etymology. The species name is inspired by the shape of the harpe of the male genitalia with a distinct median ‘ spine’. It was selected by acclamation from a shortlist by fifth and sixth grade students of the Elisabeth-Selbert-Gesamtschule in Bonn, Germany. This was part of the school’s “ Biodiversity Day ”, aiming at increasing species knowledge and re-connecting kids to nature. Remarks. Aphanogmus crispy can be distinguished from all other species of the A. fumipennis species group by the combination of the median spine of the harpe oriented distomedially and the distinct V-shaped mediodorsal notch of the harpe (Fig. 5 D). For further comparisons, see remarks under A. tkheliharpus.
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140158205