Aphanogmus latiharpus Salden & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus latiharpus Salden & Peters sp. nov. Figs 17, 18 Material examined. Holotype: Germany • ♂; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 2–16 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_T 00806 (= SMNS_Hym_Cer_001136). Paratypes: Georgia • 1 ♀; Imereti, Mukhura; 42.3194°N, 43.0613°E; ca. 780 m a. s. l.; 13–20 Jun. 2020; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042492 • 1 ♀; Tbilisi, Agricultural University of Georgia; 41.8061°N, 44.7700°E; ca. 450 m a. s. l.; 21–28 Apr. 2022; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042494 • 1 ♂; Kakheti, Vashlovani, near Alazani river; 41.1241°N, 46.6523°E; ca. 100 m a. s. l.; 21–28 Jun. 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042491 (without DNA barcode). Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 9–23 Apr. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001613 • 1 ♀; same collection data as for preceding; 4–18 Jun. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001587 • 1 ♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal, plot number 4244; 48.5050°N, 8.9935°E; ca. 370 m a. s. l.; 26 Sep. – 9 Oct. 2014; T. Kothe, M. Engelhardt, D. Bartsch leg.; Malaise trap; SMNS; SMNS_Hym_Cer_000507. Norway • 1 ♀; Telemark, Drangedal: Sannes gård; 59.0296°N, 9.2955°E; ca. 80 m a. s. l.; 23 Jun. – 19 Jul. 2021; A. Staverløkk leg.; Malaise trap; NINA; NOCER-371 • 4 ♀♀; same collection data as for preceding; 4 Aug. – 22 Sep. 2021; A. Staverløkk leg.; Malaise trap; NINA; NOCER-295, NOCER-313, NOCER-335, NOCER-288. Sweden • 1 ♂; Gotland, Eksta socken, Stora Karlsö; 57.2846°N, 17.9718°E; ca. 30 m a. s. l.; 15 Aug. 2023; Hym inventory 2023 leg.; sweep net; NHRS; NHRS -HEVA 000023408 (without DNA barcode) • 4 ♂♂; Gotland, Eksta socken, Stora Karlsö; 57.2848°N, 17.9701°E; ca. 30 m a. s. l.; 15 Aug. – 3 Sep. 2023; Hym inventory 2023 leg.; Malaise trap; NHRS; NHRS -HEVA 000023409, NHRS -HEVA 000023410, NHRS -HEVA 000023411, NHRS -HEVA 000023412 (without DNA barcodes) • 1 ♂; Gotland, Eksta socken, Stora Karlsö; 57.2841°N, 17.9700°E; ca. 30 m a. s. l.; 15 Aug. – 3 Sep. 2023; Hym inventory 2023 leg.; Malaise trap; NHRS; NHRS -HEVA 000023413 (without DNA barcode). Diagnostic description. Male. Body length: 0.60 mm. Colour (Fig. 17 A): Body light brown except antenna and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 17 A): F 1 with sensillae arranged in two whorled rows, F 1 length half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 17 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus present. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein distinctly curved, tip of vein slightly oriented towards anterior wing margin. No basal longitudinal carinae on syntergum. Male genitalia (Fig. 17 B – D): Gvc length one third of mesonotum length. Gvc width 0.78 × gvc length; harpe / gvc index 0.62. Harpe finger-shaped, occasionally with distinct diagonal striations along the basal two-thirds of the harpe, oriented from basolateral to apicomedial, harpe oriented distoventrally; lateral margin of harpe convex in basal two-thirds, straight in apical third, and oriented distomedially; median margin of harpe concave apically from basomedian spine, convex in apical third, and slightly diverging distolaterally. Harpe with distinctly sclerotized basomedian spine; tip of basomedian spine distinctly more proximal than tip of gonossiculus and oriented medially. Proximodorsal notch of harpe L-shaped. Harpe width (above basomedian spine) 0.23 × gvc width, and 0.34 × harpe length. Harpe with three median setae oriented proximomedially and distomedially, extending to apical third; harpe with at least four apical setae oriented distally; harpe with one ventral seta, oriented distolaterally. Gonossiculus length 0.64 × harpe length; gonossiculus distinct, with at least two large digital teeth, tips oriented distodorsally and dorsolaterally. Aedeagus straight. Female. Body length: 0.65 mm. Colour (Fig. 18): Body brown except scape and legs lighter. Antenna, head (Fig. 18): F 8 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends at anterior ocellus. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 18): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus slightly visible. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein distinctly curved, tip of vein slightly oriented towards anterior wing margin. Four basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 1.8 % (n = 11). Minimum interspecific barcode distance: 16.8 % (A. kintrishi). Consensus sequence: 5 ’ - AGCYAGTCTAAGACTCCTAATTCGACTTGAATTAAGAAGACCCCCTAATAATCTAATTAATAATGACTTAATCTATAATTCAATTATCACTGCTCATGCTTTCGTAATAATTTTCTTTTTAGTAATACCCATTATACTGGGAGGATTTGGTAATTGGCTCCTCCCCCTAATGATTGGTTCCCCCGATCTAGCCTTCCCTCGAATAAACAACATAAGATTCTGACTTTTACCCCCCTCCCTTACCTTACTAATCAATAGAATAATCACAAACTCAGGAACGGGAGCAGGATGAACCCTCTACCCTCCCCTTACATCCAACTTAAACCATTCAGGAATAGCAATAGATCTAACTATTTTTTCCCTCCACATCGCAGGAATTAGATCAATTATAGGATCCATCAATTTTTTAGTTACTTTATACAAAATGAAACCCCTAGCCTTCACTCAAGAAATGATACCATTATTCTGTTGATCCGTTGTAATCACTACCATTCTTTTAATCCTATCCCTCCCCGTCCTAGCGGGGGCAATCACCATAATCTTAACAGATCGAAACTTAAATACCTCCTTCTTTGACCCAAGAGGGGGGGGGGACCCCATTTTATATCAACATCTTTTT - 3 ’ Variation. In ZFMK -HYM-00042491, the interaxillar sulcus is indistinct and three basal longitudinal carinae on the syntergum are present. Biology. Unknown. Distribution. Palaearctic: Georgia, Germany, Norway, and Sweden. Etymology. The species name is a composition of the Latin word ‘ latus ’, which means ‘ broad’, and the anatomical term ‘ harpe’, with reference to the broad harpe. Remarks. Aphanogmus latiharpus is a small-bodied species with only two whorled rows of sensillae on F 1 of the male, and a distinctly curved stigmal vein on the fore wing (Fig. 17 A). It can be distinguished from all other species of the A. fumipennis species group by characters of the male genitalia, i. e, the unique combination of broad, finger-shaped harpes (harpe width 0.34 × harpe length), occasionally with distinct diagonal striations along the basal two-thirds of the harpe, oriented from proximolateral to distomedial, and a medially oriented basomedian spine of the harpe, accompanied by an L-shaped proximodorsal notch (Fig. 17 D). The imaged specimen NHRS -HEVA 000023410 has a slightly deformed dorsal mesosoma.
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140188995