Aphanogmus bispinatus Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus bispinatus Salden, Mikó & Peters sp. nov. Fig. 4; Suppl. material 2 Material examined. Holotype: Sweden • ♂; Gotland, Eksta socken, Stora Karlsö; 57.2846°N, 17.9718°E; ca. 30 m a. s. l.; 15 Aug. 2023; Hym inventory 2023 leg.; sweep net; NHRS; NHRS -HEVA 000024898 (without DNA barcode). Paratypes: Germany • 2 ♂♂; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.1675°N, 8.7903°E; ca. 180 m a. s. l.; 16–30 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_000983, SMNS_Hym_Cer_000940 • 1 ♂; same collection data as for preceding; 27 Aug. – 10 Sep. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001194 • 1 ♂; Baden-Württemberg, Tübingen, Hirschau, Oberes Tal, plot number 4244; 48.5050°N, 8.9935°E; ca. 370 m a. s. l.; 29 Aug. – 12 Sep. 2014; T. Kothe, M. Engelhardt, D. Bartsch leg.; Malaise trap; SMNS; SMNS_Hym_Cer_000495 • 1 ♂: Bavaria, Landshut, Hohenthann; 48.66°N, 12.10°E; ca. 480 m a. s. l.; 01–07 Aug. 2022; NaPa Insektenmonitoring leg.; vane trap; ZFMK; ZFMK -HYM-00042662 (without DNA barcode) • 3 ♂♂; Hesse, Werra-Meißner-Kreis, Großalmerode, private garden, Siedlerweg, semi-abandoned garden with wet spot, ivy hedge and salix; 51.2591°N, 9.7871°E; ca 380 m a. s. l.; 12–20 Jul. 2022; J. Vogel leg.; Malaise trap; ZFMK; ZFMK -HYM-00042639, ZFMK -HYM-00042643, ZFMK -HYM-00042645 (without DNA barcodes) • 1 ♂; same collection data as for preceding; 6–12 Oct. 2023; J. Vogel leg.; Malaise trap; ZFMK; ZFMK -HYM-00042646 (without DNA barcode) • 1 ♂; North Rhine-Westphalia, ZFMK garden; 50.7216°N, 7.1141°E; ca 60 m a. s. l.; 30 Aug. 2022; T. Salden leg.; sweep net; ZFMK; ZFMK -HYM-00042657 (without DNA barcode). Other material examined. Germany • 2 ♂♂; North Rhine-Westphalia, Eifel National Park, Döppeskaul; 27 Jul. – 10 Aug. 2009; J. Esser leg.; Malaise trap; UNHC; PSUC_FEM 10022624, PSUC_FEM 10012532 (without DNA barcodes) • 2 ♂♂; Baden-Württemberg, Esslingen, Oberboihingen, meadow orchard; 48.6506°N, 9.3689°E; ca. 310 m a. s. l.; 12–26 Aug. 2012; T. Kothe, G. Schweizer leg.; Malaise trap; UNHC; PSUC_FEM 10022848, PSUC_FEM 10022738 (without DNA barcodes). Hungary • 2 ♂♂; Bács-Kiskun, Gara; 46.035°N, 19.020°E; ca. 90 m a. s. l.; 26–30 Jun. 2009; I. Mikó leg.; yellow pan trap; UNHC; UNHC_1000025, UNHC_1000049 (without DNA barcodes). Slovakia • 1 ♂; Trenčín region, Hôrka nad Váhom; 12–15 Jun. 2010; E. Talamas leg.; sweep net; UNHC; PSUC_FEM 10035369 (without DNA barcode). Diagnostic description. Male. Body length: 0.76 mm. Colour (Fig. 4 A): Body dark brown. Legs with lighter joints and tarsi. Antenna, head (Fig. 4 A): F 1 with sensillae arranged in three whorled rows, F 1 length slightly shorter than half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 4 A): Scutoscutellar sulcus and transscutal articulation adjacent, interaxillar sulcus indicated. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex short. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, distal part virtually parallel to anterior wing margin. Three basal longitudinal carinae on syntergum. Male genitalia (Fig. 4 B – D): Gvc length one third of mesonotum length. Gvc width 0.66 × gvc length; harpe / gvc index 0.45. Harpe finger-shaped, distoventrally oriented; lateral margin of harpe slightly convex in basal third, straight in apical two-thirds, and oriented distomedially; median margin of harpe concave in basal half, straight in apical half, and slightly converging distomedially. Harpe with basomedian and median spine; tip of basomedian spine slightly more proximal than tip of gonossiculus and oriented distally; median spine arising from mid-length of harpe and 2 × as long as wide; tip of median spine more distal than tip of gonossiculus and oriented distomedially. Proximodorsal notch of harpe U-shaped and 0.24 × as long as harpe length. Harpe width (above median spine) 0.16 × gvc width, and 0.24 × harpe length. Harpe with four median setae oriented proximomedially and distomedially, extending to apical third; harpe with at least three apical setae oriented distally; harpe with one lateral seta close to apex, oriented distolaterally. Gonossiculus length 0.64 × harpe length; gonossiculus J-shaped with at least one digital tooth, tip oriented distolaterally and dorsolaterally. Aedeagus straight. Female. Unknown. CO 1 barcode. Maximum intraspecific barcode distance: 0.3 % (n = 4). Minimum interspecific barcode distance: 23.8 % (putative species consisting of SMNS _Hym_Cer_001083, SMNS _Hym_Cer_001801, SMNS _Hym_Cer_001672, and SMNS _Hym_Hym_027182). Consensus sequence: 5 ’ - AGCAGGCCTCAGAATAATTATCCGCTTAGAGCTTAGGTCCCCCCCCAACAATATAATAAATAATGACCTAATTTATAATTCAATTATTACAAATCACGCATTCCTCATAATCTTTTTCCTAGTCATGCCTATTATAATAGGGGGCTTTGGGAATTGGCTCCTTCCAGTAATAATGGGAGCCCCAGATCTTGCTTTCCCCCGTATAAACAATATAAGATACTGACTCCTACCTCCTTCTCTTACAATACTCCTTTTAAGGATATTAACCAACACCGGAGTTGGAGCCGGTTGAACCCTTTACCCGCCCCTGACTTTAGTCCCTTACCATGATGGTGTATCAATAGATATAACAATTTTTTCCTTACATATCGCGGGAATTAGTTCAATTATAGGTTCTATCAATTTTTTAGTAACAGCCTTTAAAATAAAGCCTCTAAATATAGACTTAGTAAAACTTCCCTTATTCTGTTGATCAGTTATCCTCACGGCTCTCCTTCTAATCCTATCCTTACCTGTCCTAGCCGGAGCCATCACAATAATTTTAACTGACCGTAACATAAACACCTCCTTTTTTGACCCAGAAGGAGGAGGTGACCCACTTTTATACCAACACCTTTTT - 3 ’ Variation. Body light brown in DNA-extracted specimens SMNS _Hym_Cer_000983, SMNS _Hym_Cer_000940, SMNS _Hym_Cer_001194, and SMNS _Hym_Cer_000495. Biology. Unknown. Distribution. Palaearctic: Germany, Hungary, Slovakia, and Sweden. Etymology. The species name is a composition of the Latin words ‘ bi ’ and ‘ spina ’, meaning ‘ two’ and ‘ spine’, with reference to the distinct two spines along the median margin of the harpe. Remarks. A. bispinatus can be readily distinguished from all other species of the A. fumipennis species group by the morphology of the male genitalia, specifically the presence of two spines on the harpe: a basomedian spine and a median spine, the latter being twice as long as wide and oriented distomedially (Fig. 4 D). In the molecular analyses, two additional specimens (SMNS _Hym_Cer_001034 and ZFMK -HYM-00042561) were assigned to the same species as the four A. bispinatus specimens by both ASAP and mPTP and show only comparatively small barcode distance to A. bispinatus (5.3 %). However, the male genitalia of these specimens differ distinctly from those of A. bispinatus, indicating that they represent different species (see remarks under A. karlazani).
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Language: English
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140190851