Aphanogmus vashlovani Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus vashlovani Salden, Mikó & Peters sp. nov. Figs 23, 24; Suppl. material 15 Material examined. Holotype: Georgia • ♂; Kakheti, Vashlovani, near Alazani river; 41.1241°N, 46.6523°E; ca. 100 m a. s. l.; 21–28 Jun. 2021; G. Japoshvili leg.; Malaise trap; ECAUG; ZFMK -HYM-00042529. Paratype: Georgia • 1 ♀; same data as for holotype; ZFMK; ZFMK -HYM-00042530. Other material examined. Georgia • 1 ♀; Mtskheta-Mtianeti, Tbilisi National Park; 41.8797°N, 45.0216°E; ca 1280 m a. s. l.; 27 May 2022; T. Salden leg.; sweep net; ZFMK; ZFMK -HYM-00042534 • 1 ♀; Kakheti, Batsara Nature Reserve; 42.2229°N, 45.3029°E; ca 810 m a. s. l.; 28 May 2022; T. Salden, R. S. Peters leg.; Winkler leaf litter extraction; ZFMK; ZFMK -HYM-00042535 • 1 ♀; Kakheti, Batsara Nature Reserve; 42.2244°N, 45.3003°E; ca 820 m a. s. l.; 28 May 2022; T. Salden, R. S. Peters leg.; Winkler leaf litter extraction; ZFMK; ZFMK -HYM-00042536 • 2 ♀♀; Kakheti, Telavi; 41.9134°N, 45.4588°E; ca. 820 m a. s. l.; 28 May 2022; T. Salden, R. S. Peters leg.; yellow pan trap; ZFMK; ZFMK -HYM-00042537, ZFMK -HYM-00042538 • 1 ♀; same collection data as for preceding; 29 May 2022; T. Salden, R. S. Peters leg.; yellow pan trap; ZFMK -HYM-00042533 • 21 ♀♀; Kakheti, Telavi; 41.9132°N, 45.4556°E; same collection data as for preceding; ZFMK; ZFMK -HYM-00042539, ZFMK -HYM-00042540, ZFMK -HYM-00042541, ZFMK -HYM-00042542, ZFMK -HYM-00042543, ZFMK -HYM-00042544, ZFMK -HYM-00042546, ZFMK -HYM-00042547, ZFMK -HYM-00042548, ZFMK -HYM-00042549, ZFMK -HYM-00042550, ZFMK -HYM-00042553, ZFMK -HYM-00042554, ZFMK -HYM-00042555, ZFMK -HYM-00042556, ZFMK -HYM-00042559, ZFMK -HYM-00042560, ZFMK -HYM-00042566, ZFMK -HYM-00042567, ZFMK -HYM-00042569, ZFMK -HYM-00042570 • 15 ♀♀; same collection data as for preceding; 30 May 2022; T. Salden, R. S. Peters leg.; yellow pan trap; ZFMK; ZFMK -HYM-00042575, ZFMK -HYM-00042576, ZFMK -HYM-00042577, ZFMK -HYM-00042579, ZFMK -HYM-00042580, ZFMK -HYM-00042581, ZFMK -HYM-00042582, ZFMK -HYM-00042584, ZFMK -HYM-00042585, ZFMK -HYM-00042586, ZFMK -HYM-00042587, ZFMK -HYM-00042588, ZFMK -HYM-00042589, ZFMK -HYM-00042591, ZFMK -HYM-00042592 • 2 ♀♀; Kakheti, Lagodekhi National Park; 41.8091°N, 46.3224°E; ca. 500 m a. s. l.; 30 May 2022; T. Salden, R. S. Peters leg.; sweep net; ZFMK; ZFMK -HYM-00042572, ZFMK -HYM-00042574 • 2 ♀♀; Kakheti, Sighnaghi; 41.6233°N, 45.9184°E; ca. 770 m a. s. l.; 1 Jun. 2022; T. Salden, R. S. Peters leg.; yellow pan trap; ZFMK; ZFMK -HYM-00042593, ZFMK -HYM-00042594 • 1 ♀; Kakheti, Vashlovani, Takhistskali; 41.1254°N, 46.6496°E; ca. 110 m a. s. l.; 21–28 Jun. 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042595 • 1 ♀; Tbilisi, Agricultural University of Georgia; 41.8061°N, 44.7700°E; ca. 450 m a. s. l.; 21–28 Apr. 2022; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042573 • 1 ♀; Kakheti, Babaneuri; 42.0757°N, 45.3677°E; ca. 440 m a. s. l.; 30 Jun. – 9 Jul. 2022; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042597 • 2 ♀♀; Racha-Lechkhumi & Kvemo Svaneti, Onchevi, Shola; 42.5585°N, 43.5193°E; ca. 1160 m a. s. l.; 20–27 May 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042527, ZFMK -HYM-0004252 • 1 ♀; Imereti, Mukhura; 42.3194°N, 43.0613°E; ca. 780 m a. s. l.; 20–27 Jun. 2020; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042526 • 1 ♂; Racha-Lechkhumi & Kvemo Svaneti, Tsageri, Doghurashi; 42.6698°N, 42.7854°E; ca. 1000 m a. s. l.; 18–24 Aug. 2020; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042525. Germany • 1 ♀; Baden-Württemberg, Karlsruhe, Östringen, NSG 2.217 Apfelberg, plot number 9836; 49.16754°N, 8.7903°E; ca. 180 m a. s. l.; 16–30 Jul. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_000961 • 1 ♂; same collection data as for preceding; 27 Aug. – 10 Sep. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001188 • 1 ♀; same collection data as for preceding; 9–23 Apr. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001614 • 1 ♀; same collection data as for preceding; 4–18 Jun. 2019; LUBW Insektenmonitoring leg.; Malaise trap; SMNS; SMNS_Hym_Cer_001228. Other material examined. Hungary • 2 ♂♂; Veszprém, Nyirád; 2 Jun. 2010; E. Talamas leg.; sweep net; UNHC; PSUC_FEM 10035329, PSUC_FEM 10035310 (without DNA barcodes). Diagnostic description. Male. Body length: 0.65 mm. Colour (Fig. 23 A): Body brown except metasoma, antenna, and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 23 A): F 1 with sensillae arranged in at least three whorled rows, F 1 length half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 23 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein distinctly curved, tip of vein slightly oriented towards anterior wing margin. Three basal longitudinal carinae on syntergum. Male genitalia (Fig. 23 B – D): Gvc length one third of mesonotum length. Gvc width 0.66 × gvc length; harpe / gvc index 0.60. Harpe finger-shaped, distoventrally oriented; lateral margin of harpe slightly convex in basal half, straight in apical half, and slightly oriented distomedially; median margin of harpe convex in basal third, slightly concave in apical two-thirds, and slightly converging distomedially. Harpe without spines along median margin. Proximodorsal notch of harpe absent. Harpe width (above convex median extension) 0.26 × gvc width, and 0.26 × harpe length. Harpe with four median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least five apical setae oriented distally, including one broadened seta (broadening only visible in CLSM image Suppl. material 15); harpe with one distinct ventral seta, oriented distolaterally. Gonossiculus length 0.38 × harpe length; gonossiculus bulbous with at least two digital teeth, tips oriented dorsally. Aedeagus straight. Female. Body length: 0.80 mm. Colour (Fig. 24): Body brown except metasoma and legs lighter. Antenna, head (Fig. 24): F 8 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 24): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus present. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight and distinct, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein distinctly curved, tip of vein slightly oriented towards anterior wing margin. Three basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 5.1 % (n = 59). Minimum interspecific barcode distance: 17.8 % (putative species consisting of ZFMK -HYM-00042521, ZFMK -HYM-00042522, ZFMK -HYM-00042519, ZFMK -HYM-00042520, NOCER-374, and NOCER-388). Consensus sequence: 5 ’ - AGCAAGTCTTAGATTATTAATCCGCCTTGAGCTCAGAAGACCCCCCAATAACCTAATTAACAATGACTTAACCTATAACTCAATCATCACAGCCCACGCTTTTGTAATAATTTTCTTTCTTGTAATACCCATCATACTGGGGGGGTTTGGAAATTGATTACTCCCACTAATAATTGGATCCCCCGACCTTGCATTCCCCCGGATAAATAATATAAGATTCTGACTCCTCCCCCCCTCCCTCACCCTTCTAATAAATAGGATACTCATAAACTCGGGAACCGGGGCAGGGTGGACCCTATACCCCCCCCTGACATCCAATCTCCACCACGCTGGAATAGCCATAGATTTAACAATTTTCTCCCTTCACGTAGCTGGTATCAGTTCAATTATAGGGTCAATCAACTTCCTGGTCACCCTATATAAAATAAAACCAAGAAATTTAAATTACGAAATAATACCTCTTTTTTGTTGATCCGTAGCAGTTACTACTATCTTACTAATTTTATCCCTCCCCGTCCTAGCAGGTGCCATCACTATAATTTTAACAGACCGAAATCTTAATACCTCCTTTTTCGATCCCGCCGGAGGAGGAGACCCCGTATTATACCAGCACCTATTT - 3 ’ Variation. Unknown. Biology. Unknown. Distribution. Palaearctic: Georgia. Etymology. The species is named after the Vashlovani National Park, where the type series were collected. The species epithet is treated as a noun in apposition. Remarks. The convex median extension along the basal third of the harpe and the finger-shaped apical two-thirds of the harpe in Aphanogmus vashlovani (Fig. 23 D) has some resemblance to the male genitalia of A. fraterculus Salden & Peters, 2023 from the Afrotropical A. fumipennis species group. However, the proportions and setal arrangement of the genitalia differ clearly between the two species. The molecular species delimitation analyses result in different species clusters depending on the method applied. The mPTP analysis grouped 59 sequences into a single cluster, with an intraspecific barcode distance of 5.1 %. The spID analysis split these 59 sequences into two clusters, one containing 51 sequences and the other eight sequences, with a barcode distance of 5.1 % between the clusters. The ASAP analysis separated the same 59 sequences into four clusters: one cluster with two specimens, one cluster with 49 sequences, and two clusters with four sequences each. The two specimens ZFMK -HYM-00042529 (male), ZFMK -HYM-00042530 (female) are designated as holotype and paratype, because they consistently cluster together in all three delimitation methods and the male has well-diagnosable genitalia. The remaining 57 specimens are assigned to A. vashlovani but not designated as paratypes. Specifically, the cluster of 49 sequences found with ASAP has a maximum distance of 2.6. % to the type series. Unfortunately, it includes only female specimens which are difficult to assess morphologically. The
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140228800