Aphanogmus zefranki Salden, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus zefranki Salden, Mikó & Peters sp. nov. Fig. 27; Suppl. material 18 Material examined. Holotype: Georgia • ♂; Kakheti, Vashlovani; 41.1570°N, 46.5601°E; ca. 290 m a. s. l.; 20–28 Jun. 2021; G. Japoshvili leg.; Malaise trap; ECAUG; ZFMK -HYM-00042448. Paratypes: Georgia • 2 ♂♂; same data as for holotype; ZFMK; ZFMK -HYM-00042450, ZFMK -HYM-00042453 • 2 ♂♂; Kakheti, Vashlovani, near Alazani river; 41.1241°N, 46.6523°E; ca. 100 m a. s. l.; 21–28 Jun. 2021; G. Japoshvili leg.; Malaise trap; ZFMK; ZFMK -HYM-00042454, ZFMK -HYM-00042455 • 1 ♂; same data as for holotype; ZFMK; ZFMK -HYM-00042457 (without DNA barcode). Diagnostic description. Male. Size: 0.70 mm. Colour (Fig. 27 A): Body brown except metasoma, antenna and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 27 A): F 1 with sensillae arranged in three whorled rows, F 1 length shorter than half of scape length. Preoccipital lunula absent. Preoccipital furrow slightly visible. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 27 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex absent. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. No basal longitudinal carinae on syntergum. Male genitalia (Fig. 27 B – D): Gvc length one third of mesonotum length. Gvc width 0.76 × gvc length; harpe / gvc index 0.47. Harpe finger-shaped, distoventrally oriented, and with straight apex in lateral view; lateral margin of harpe convex in basal half, straight in apical half, and oriented distomedially; median margin of harpe slightly concave and converging distomedially. Harpe with basomedian and median spine; tip of basomedian spine more proximal than tip of gonossiculus and oriented distally; median spine arising from basal third of harpe and 4 × as long as wide and distinctly rounded; tip of median spine more distal than tip of gonossiculus and oriented medially. Proximodorsal notch of harpe U-shaped and 0.21 × as long as harpe length. Harpe width (above median spine) 0.18 × gvc width, and 0.28 × harpe length. Harpe with five median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least three apical setae oriented distally, including one broadened seta (broadening only visible in CLSM image Suppl. material 18); harpe with one lateral seta close to apex, oriented distolaterally. Gonossiculus length 0.41 × harpe length; gonossiculus C-shaped with at least one digital tooth, tip oriented dorsolaterally. Aedeagus straight. Female. Unknown. CO 1 barcode. Maximum intraspecific barcode distance: 0.0 % (n = 5). Minimum interspecific barcode distance: 12.1 % (A. ventricoharpus). Consensus sequence: 5 ’ - AGCAGGATTAAGATTTATTATTCGACTTGAATTAAGATCCCCCCCAAATAACCTAATAAACAATGATTTAATTTATAACTCTGTAATTACTAATCATGCTTTCCTGATAATTTTTTTTTTAGTTATACCCATTATACTTGGAGGATTTGGAAATTGACTAATCCCAATTATAATTGGATCACCAGATTTAGCCTTCCCTCGAATAAATAATATAAGACTTTGATTACTTCCTCCTTCTTTGACTCTTCTCCTTAGAAGAATAATAACTAATACAGGTGTAGGAGCAGGATGAACCCTTTACCCTCCTCTAACTTTAGTACCCTTTCATGATGGTATATCAATAGATCTAACAATTTATTCTCTTCATATCGCAGGAATCAGTTCTATTATAGGTTCAATTAATTTTATAGTAACAACTTACAAAATAAAACCCTCCTTCCAAAATCTAATTTCCCTCCCCTTATTCTGTTGATCAATTATAATTACATCCCTTCTTTTACTTTTATCCCTTCCTGTTTTAGCGGGAGCTGTAACAATAATTCTAACAGACCGAAACTTAAATACTTCTTTTTTCGACCCGGAAGGAGGGGGAGACCCCTTACTCTACCAACACCTATTT - 3 ’ Variation. The anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex is present and short in ZFMK -HYM-00042454. Biology. Unknown. Distribution. Palaearctic: Georgia. Etymology. The species is named after Hosea Jan Frank, better known as Ze Frank, a popular YouTube creator. He presents " True Facts “ about biodiversity and Morgan Freeman in an artistic, humorous, and scientific manner. Remarks. Aphanogmus zefranki can be easily distinguished from all other species of the A. fumipennis species group by its distinct median spine of the harpe which is 4 × as long as wide, distinctly rounded, and medially oriented (Fig. 27 D).
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Language: English
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140197506