Aphanogmus digitangulus Salden, Staverlokk, Miko & Peters 2026, sp. nov.
Year: 2026
Type: article
Abstract: Aphanogmus digitangulus Salden, Staverløkk, Mikó & Peters sp. nov. Figs 7, 8; Suppl. materials 5, 6 Material examined. Holotype: Norway • ♂; Trøndelag, Malvik: Buåsen; 63.3939°N, 10.6526°E; ca. 210 m a. s. l.; 5–27 Aug. 2019; A. Staverløkk leg.; Malaise trap; NINA; NOCER-081. Paratypes: Norway • 1 ♀; Telemark, Drangedal: Sannes gård; 59.0296°N, 9.2955°E; ca. 80 m a. s. l.; 23 Jun. – 19 Jul. 2021; A. Staverløkk leg.; Malaise trap; NINA; NOCER-376 • 1 ♀; Aurskog-Høland, Mikkelsrud; 59.9754°N, 11.6683°E; ca. 300 m a. s. l.; 1 Aug. – 12 Sep. 2022; A. Staverløkk leg.; Malaise trap; NINA; NOCER-809. Georgia • 1 ♂; Adjara, Kintrishi; 41.7372°N, 41.9792°E; ca. 400 m a. s. l.; 5–19 Oct. 2018; L. Mumladze leg.; Malaise trap; ECAUG; ZFMK -HYM-00042447 (without DNA barcode). Other material examined. Czech Republic • 1 ♂; South Moravia, Lednice, riparian forest; 9 Aug. 1991; L. Masner leg.; sweep net; UNHC; UNHC_1000014 (without DNA barcode). Germany • 1 ♂; Saxony, Bautzen, Driewitz; 51.3456°N, 14.4348°E; ca. 150 m a. s. l.; 30 Jul. 2013; L. Krogmann, T. Kothe leg.; sweep net; UNHC; 10022921 (without DNA barcode) • 1 ♂; Baden-Würrtemberg, Tübingen, Bebenhausen, Goldersbachtal; 48.5586°N, 9.0522°E; ca. 370 m a. s. l.; 22 Jun. 2012; L. Krogmann, T. Kothe, S. Kurz leg.; sweep net; UNHC; 10022929 (without DNA barcode). Sweden • 2 ♂♂; Stenbrohult, Djäknabygds bokbacke, heath with old beeches; 1–18 Aug. 2003; UNHC; IM 2146, IM 2148 (without DNA barcodes) • 2 ♂♂; same collection data as for preceding; 1–15 Jul. 2003; UNHC; IM 2155, IM 2156 (without DNA barcodes) • 1 ♂; Vindelns kommun, Kulbäckslidens försökspark, dense mixed coniferous 20–25 yr old forest, Trap ID 60; 18 Aug. – 1 Sep. 2003; UNHC; IM 2151 (without DNA barcode). Diagnostic description. Male. Body length: 0.80 mm. Colour (Fig. 7 A): Body brown. Antenna and legs slightly lighter and legs with lighter joints and tarsi. Antenna, head (Fig. 7 A): F 1 with sensillae arranged in three whorled rows, F 1 length half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 7 A): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus absent. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex short. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Four basal longitudinal carinae on syntergum. Male genitalia (Fig. 7 B – D): Gvc length one third of mesonotum length. Gvc width 0.69 × gvc length; harpe / gvc index 0.46. Harpe finger-shaped, distoventrally oriented; lateral margin of harpe slightly convex in basal third, concave in apical two-thirds, and slightly oriented distomedially; median margin of harpe slightly convex and slightly converging distomedially. Harpe without spines along median margin; harpe with rectangular median extension along basal third. Proximodorsal notch of harpe absent. Harpe width (above rectangular median extension) 0.13 × gvc width, and 0.19 × harpe length. Harpe with three median setae oriented proximomedially and distomedially, restricted to apical quarter; harpe with at least four apical setae oriented distoventrally; harpe with one distinct lateral seta close to apex, oriented distolaterally. Gonossiculus length 0.61 × harpe length; gonossiculus J-shaped with at least two digital teeth and apically slightly serrated, tip oriented distodorsally and distolaterally. Aedeagus straight. Female. Body length: 0.85 mm. Colour (Fig. 8): Body light brown except metasoma and legs lighter. Legs with lighter joints and tarsi. Antenna, head (Fig. 8): F 8 length longer than half of scape length. Preoccipital lunula absent. Preoccipital furrow present. Preoccipital furrow ends anteriorly at POL. Ocellar fovea margin absent. Anterior ocellar fovea slightly visible. Ocular impression and orbital carina absent. Mesosoma, fore wing, metasoma (Fig. 8): Scutoscutellar sulcus and transscutal articulation not adjacent, interaxillar sulcus indistinct. Anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex straight, triangular in dorsal view. Dorsal region of anteromedian projection of the metanoto-propodeo-metapecto-mesopectal complex setose. Mesometapleural sulcus absent. Epicnemial carina present. Epicnemial pit absent. Stigmal vein curved, tip of vein slightly oriented towards anterior wing margin. Two basal longitudinal carinae on syntergum. CO 1 barcode. Maximum intraspecific barcode distance: 1.2 % (n = 3). Minimum interspecific barcode distance: 14.9 % (A. ventricoharpus). Consensus sequence: 5 ’ - AGCCGGATTAAGACTAATTATCCGCCTTGAACTTAGATCCCCCCCTAATACCATAATTAATAATGACCTAATCTACAACTCTGTAATCACAAACCATGCCTTCCTAATAATTTTTTTCCTAGTTATACCTATTATACTAGGAGGATTCGGAAACTGATTAATCCCTATTATAATCGGGGCCCCTGATTTAGCCTTCCCTCGTATAAATAATATAAGACTATGATTACTCCCCCCCTCTTTAACCCTCCTCCTAATAAGAATAATAACCAACACAGGGGTGGGGGCAGGATGAACCCTTTACCCCCCTTTAACTTTAATVCCCTTTCATGACGGCATATCAATAGACTTAACAATTTACTCTCTCCATATTGCAGGAGTTAGCTCAATTATAGGCTCAATTAATTTTATAGTAACAACTTATAAAATAAAACCCCTTCCTCAACTAATAATATCCCTCCCCCTATTTTGTTGATCAATCATAATTACCTCCCTCCTCCTTTTACTATCTCTCCCTGTACTAGCTGGTGCCGTAACAATAATCCTTACCGACCGAAACTTAAATACTTCCTTTTTCGATCCAGAGGGGGGAGGGGACCCCTTACTTTACCAACATCTATTC - 3 ’ Variation. The interaxillar sulcus is present in 10022921 and 10022929 (visible in µCT image Suppl. material 6). Biology. Unknown. Distribution. Palaearctic: Czech Republic, Georgia, Germany, Norway, and Sweden. Etymology. The species name is a composition of the Latin words ‘ digitus ’ and ‘ rectangulus ’, meaning ‘ finger’ and ‘ rectangular’, with reference to the male genitalia with a finger-shaped harpe and a rectangular median extension along the basal third of the harpe. Remarks. Aphanogmus digitangulus is unique among all species of the A. fumipennis species group by its rectangular median extension along the basal third of the harpe, combined with the harpe lacking both spines and a proximodorsal notch (Fig. 7 D). For further comparisons, see remarks under A. fumipennis.
Institutions: Leibniz Institute for the Analysis of Biodiversity Change, University of New Hampshire, Norwegian Institute for Nature Research, Staatliches Museum für Naturkunde Stuttgart, Karlsruhe Institute of Technology, University of Cologne, Ilia State University, Agricultural University of Georgia
Domain: Life Sciences
Open Access status: green
OpenAlex ID: W7140167973